ORF

Genetika molekularrean, irakurtarau ireki edo ORF bat (Open reading frame ingelesez) hasierako kodoi baten (AUG) eta bukaera kodoi baten arteko DNA sekuentzia bat da, introiei dagokien sekuentziak kontuan hartu gabe. UTRen artean agertzen dira, hau da, itzultzen ez diren sekuentziak.
DNA sekuentzia batean, printzipioz, sei zentzu posibletan ager daitezke irakurtarauak; kodoi bakoitzak hiru nukleotido hartzen dituenez, hiru hasiera leku dago kodoiak hirunaka hartzeko, laugarren nukleotido bat hasiera gisa hartuz gero, lehenbiziko irakurtarauarekin kointzidituko zuelarik. Hiru irakurtarau hauei beste hiru gehitu behar zaizkio aurkako zentzuan, itzulpena DNAren harizpi osagarria molde gisa hartuta gertatzen bada.
Sei irakurtarau hauek +1, +2, +3, -1, -2 eta -3 izena hartzen dute
5' aactgcagtacgtaacgtca 3' sekuentzia adibide gisa hartuta, hauek dira irakurtarauak:
+3 5' aa ctg cag tac gta acg tca 3' +2 5' a act gca gta cgt aac gtc a 3' +1 5' aac tgc agt acg taa cgt ca 3' -1 3' ttg acg tca tgc att gca gt 5' -2 3' t tga cgt cat gca ttg cag t 5' -3 3' tt gac gtc atg cat tgc agt 5'
Irakurtarau bakoitzak sekuentzia proteiko zeharo ezberdina emango du.
Ikus, gainera
Kanpo estekak
Content Disclaimer
Informasi ini disarikan dari Wikipedia dan disajikan kembali untuk tujuan edukasi. Konten tersedia di bawah lisensi CC BY-SA 3.0. Kami tidak bertanggung jawab atas ketidakakuratan data yang bersumber dari kontribusi publik tersebut.
- The information displayed on this website is sourced in part or in whole from Wikipedia and has been adapted for the purpose of restating it. We strive to provide accurate and relevant information, however:
- There is no guarantee of absolute accuracy. Wikipedia is an open, collaborative project that can be edited by anyone, so information is subject to change.
- It is not intended to constitute professional advice. The content displayed is for informational and educational purposes only. For important decisions (e.g., medical, legal, or financial), please consult a professional.
- Content copyright. Wikipedia is licensed under the Creative Commons Attribution-ShareAlike License (CC BY-SA). This means that content may be reused with appropriate attribution and shared under a similar license.
- Responsible use. Any risk arising from the use of information from this website is entirely the responsibility of the user.









